site stats

Lifeact-tdtomato

Web31. jan 2024. · pGIIB/pRPS5A::Lifeact:tdTomato:tNOS was generated by introducing the oligonucleotide dimer Lifeact into pGIIB/pRPS5A::LIC:tdTomato:tNOS through ligation-independent cloning. pGIIB/pRPS5A::LIC:tdTomato:tNOS was generated by ligating BamHI-linearized pPLV28 with tdTomato excised from pPLV23 (de Rybel et al., 2011).

Arp2/3-mediated F-actin formation controls regulated exocytosis

WebLifeAct (N terminal on insert) Cloning Information Cloning method Ligation Independent Cloning 5′ sequencing primer tttatgctccaagcggagac 3′ sequencing primer … WebPlasmid pGI3EM22C from Dr. Nicolas Buchler's lab contains the insert hph SpunH2A/Bpr LifeAct-tdTomato and is published in Elife. 2024 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. This plasmid is available through Addgene. dr jason diamond plastic surgeon https://gpfcampground.com

Addgene: pGI3EM22C

Web08. sep 2024. · Lifeact-tdTomato is presented in a pseudocolor and a corresponding color bar is shown in the first frame (intensity ranges: 979–13,000 (a), 184–4000 (b)). The top … WebU2OS cells expressing Lifeact-tdTomato and stained with MitoTracker Green. Top row: single-camera configuration. Bottom row: dual-camera configuration. Crosstalk is … Web20. apr 2024. · Lifeact, a 17 amino-acid peptide, when fused to tdTomato, stains F-actin structures without interfering actin dynamics in vitro or in vivo . Upon AMPK activation, increased F-actin remodeling was observed in WT cells as shown by increased Lifeact-tdTomato fluorescence under TIRFM ( Figures 5A, B and Supplementary Figure 5B and … dr jason dickerson podiatry

Time-lapse two-color 3D imaging of live cells with doubled ... - PNAS

Category:ZEISS Lattice Lightsheet 7

Tags:Lifeact-tdtomato

Lifeact-tdtomato

Collectively stabilizing and orienting posterior migratory forces ...

Web07. dec 2015. · Sgs3-GFP was recombined with Bloomington #3554 to generate Sgs3-GFP, UAS-Lifeact-Ruby. Sgs3-GFP was recombined with Bloomington #3222 1to generate Sgs3-GFP , UAS-Myr-tdTomato . WebPrior to compaction, the niche is a loose aggregate of somatic cells at the gonad anterior (Figure 5A, green), surrounded by germline cells labeled with nos-lifeact::tdtomato 29 (see Table of Materials), the first tier of which will be germline stem cells (Figure 5A, magenta).

Lifeact-tdtomato

Did you know?

Web07. jan 2024. · The Lifeact sequence was initially reported in Riedl, J. et al. Lifeact: a versatile marker to visualize F-actin. Nat Methods 5, 605 607 (2008). Please cite the … Webin a dividing tissue, we collected a set of Lifeact fluorescent reporters (Table 1 ), tagged with YFPv (Doumane et al., 2024), tdTomato (Liao & Weijers, 2024). We generated a blue-tagged version of Lifeact with 2xmTURQUOISE2 (2xmTU2) under a Ub10 promoter (Ub10pro:Lifeact-2xmTU2). Using the recently

Web05. mar 2024. · The activation-induced increase in fluorescence is not observable in effector T cells isolated from fluorescent reporters other than Lifeact-EGFP. Neither tdTomato … WebTg(myl7:LIFEACT-GFP) WT donor cells (green) were transplanted to the margin of Tg(myl7:LIFEACT-tdTomato) WT host embryos (red) at the blastula stage and imaged at 50 hpf. Cite Request full-text

WebPlasmid pLenti-Lifeact-tdTomato from Dr. Weiping Han's lab contains the insert Lifeact and is published in Nat Commun. 2015 Jan 9;6:5951. doi: 10.1038/ncomms6951. This … Web22. nov 2024. · The average tdTomato fluorescence signal intensity was documented and defined as the cytosolic Lifeact-tdTomato signal. 4 to 5 optical sections above the …

Web19. mar 2012. · To demonstrate time-lapse multicolor imaging, we imaged the dynamics of the actin cytoskeleton and mitochondria in HeLa cells expressing tdTomato-LifeAct and …

Web22. nov 2024. · The average tdTomato fluorescence signal intensity was documented and defined as the cytosolic Lifeact-tdTomato signal. 4 to 5 optical sections above the nucleus were used for the selection of ROIs. The optical sections containing the nucleus were not selected for the measurement to avoid interference from the perinuclear actin arches. dr jason edwards oncologyWebover-expression. In addition, it also shows colocalization between Lifeact-tdTomato and phalloidin staining in axons from adult retina explants and illustrates the maintenance of phalloidin staining after laser cut in the tip of the axon with the over-expression of DCLK2 and DCX-SP, compare to PLAP and DCX-270. dr jason dunn cleveland tnWebtdTomato-Lifeact-7 Citations (2) Plasmid Article: Time-lapse two-color 3D imaging of live cells with doubled resolution using structured illumination. Fiolka R, Shao L, Rego EH, … dr jason edwards oral surgeonWebPlasmid tdTomato-Lifeact-7 from Dr. Michael Davidson's lab is published in Proc Natl Acad Sci U S A. 2012 Apr 3;109(14):5311-5. doi: 10.1073/pnas.1119262109. Epub 2012 Mar … dr jason efford bay robertsWeb2 days ago · h, Images showing WT and SAPAP3 KO tdTomato + astrocytes. i, Left, LifeAct GFP mean actin intensity as a function of distance from astrocyte somata (points represent mean intensity from 15–18 ... dr jason diamond rhinoplastyWeb30. nov 2009. · pAL2-Lifeact P ccg-1 Lifeact tdTomato T trpC bar /ignite 756 . pAL3-Lifeact P ccg-1 Lifeact TagRFP T trpC bar /ignite 757 . pAL4-Lifeact P ccg-1 Lifeact … dr jason edwards radiation oncologyWebLifeact-RFP reporter construct. The first red fluorescent Lifeact probe that we adopted for the filamentous model fungus Neurospora crassa was Lifeact-tdTomato (Roca et al., … dr. jason edwards chesterfield mo